Kbtbd13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kbtbd13^em1(IMPC)J
• Name: kelch repeat and BTB (POZ) domain containing 13; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6379319
• Gene: Kbtbd13 Location: Chr9:65295966-65298934 bp, - strand Genetic Position: Chr9, 35.28 cM, cytoband D
• Alliance: Kbtbd13^em1(IMPC)J page
• IMPC: Kbtbd13 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGGCAGTGCGGTGGCCAC and CATCATGCCCCCAGGCCCCG, which resulted in a 1340 bp deletion beginning at Chromosome 9 position 65,390,300 bp and ending after 65,391,639 bp (GRCm38/mm10). This mutation deletes 1340 bp from ENSMUSE00000424249 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kbtbd13 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)