Polr2gem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Polr2gem1(IMPC)J |
Name: |
polymerase (RNA) II (DNA directed) polypeptide G; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6378226 |
Gene: |
Polr2g Location: Chr19:8770493-8775921 bp, - strand Genetic Position: Chr19, 5.62 cM
|
Alliance: |
Polr2gem1(IMPC)J page
|
IMPC: |
Polr2g gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTATTCATAGAAAGGTTATG and TCAATGAACCATCTGAACAG, which resulted in a 480 bp deletion beginning at Chromosome 19 position 8,797,208 bp and ending after 8,797,687 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000621714 (exon 3) and 320 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 41 amino acids later. There is a single bp insertion A at the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|