About   Help   FAQ
Psma8em1Amp
Endonuclease-mediated Allele Detail
Summary
Symbol: Psma8em1Amp
Name: proteasome subunit alpha 8; endonuclease-mediated mutation 1, Alberto M Pendas
MGI ID: MGI:6376660
Synonyms: Psma8-
Gene: Psma8  Location: Chr18:14839208-14895358 bp, + strand  Genetic Position: Chr18, 8.25 cM, cytoband A2
Alliance: Psma8em1Amp page
Mutation
origin
Strain of Origin:  (C57BL/6J x CBA/J)F2
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/Cas9 genome editing technology was used with two sgRNAs (targeting GGGCATACTCCACTTGGAAA and ACCGCGGTAAGCTGCTCCCC) to generate a 56 base pair deletion encompassing the last three nucleotides of the coding region of exon 1 and intronic sequence at the 5' end of intron 1 (GRCm39:chr18:14839387-14839442). The deletion of the exon/intron 1 splice donor site cause anomalous splicing of the truncated exon 1 to a cryptic exon in intron 1, followed by splicing to exon 2 and onward. (J:279007)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Psma8 Mutation:  21 strains or lines available
References
Original:  J:279007 Gomez-H L, et al., The PSMA8 subunit of the spermatoproteasome is essential for proper meiotic exit and mouse fertility. PLoS Genet. 2019 Aug;15(8):e1008316
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory