Psma8^em1Amp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Psma8^em1Amp
• Name: proteasome subunit alpha 8; endonuclease-mediated mutation 1, Alberto M Pendas
• MGI ID: MGI:6376660
• Synonyms: Psma8^-
• Gene: Psma8 Location: Chr18:14839208-14895358 bp, + strand Genetic Position: Chr18, 8.25 cM, cytoband A2
• Alliance: Psma8^em1Amp page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA/J)F2

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 genome editing technology was used with two sgRNAs (targeting GGGCATACTCCACTTGGAAA and ACCGCGGTAAGCTGCTCCCC) to generate a 56 base pair deletion encompassing the last three nucleotides of the coding region of exon 1 and intronic sequence at the 5' end of intron 1 (GRCm39:chr18:14839387-14839442). The deletion of the exon/intron 1 splice donor site cause anomalous splicing of the truncated exon 1 to a cryptic exon in intron 1, followed by splicing to exon 2 and onward. (J:279007)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Psma8 Mutation: 21 strains or lines available

References

• Original: J:279007 Gomez-H L, et al., The PSMA8 subunit of the spermatoproteasome is essential for proper meiotic exit and mouse fertility. PLoS Genet. 2019 Aug;15(8):e1008316
• All: 2 reference(s)