Tg(Foxa2-EGFP)1Jbri
Transgene Detail

Summary

• Symbol: Tg(Foxa2-EGFP)1Jbri
• Name: transgene insertion, James Briscoe
• MGI ID: MGI:6376096
• Synonyms: 8GBS-hsp68-eGFP, Tg(GBS-GFP)Jbri
• Transgene: Tg(Foxa2-EGFP)1Jbri Location: unknown
• Alliance: Tg(Foxa2-EGFP)1Jbri page

Transgene origin

• Strain of Origin: FVB/N

Transgene description

• Transgene Type: Transgenic (Reporter)
• Mutation: Insertion
• Mutation details: Eight concatemerized fragments of a FoxA2 enhancer that contains a Gli binding site (GBS; TTATGACGGAGGCTAACAAGCAGGGAACACCCAAGTAGAAGCTGGCTGTC) and hsp68 minimal promoter drivie expression of an EGFP reporter gene. The transgene is flanked by two copies of the chicken beta-globin insulator. The pound symbol (#) is used when no line is specified and/or lines are pooled. (J:181293)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available

References

• Original: J:181293 Balaskas N, et al., Gene regulatory logic for reading the Sonic Hedgehog signaling gradient in the vertebrate neural tube. Cell. 2012 Jan 20;148(1-2):273-84
• All: 3 reference(s)