Sptb^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sptb^em1(IMPC)J
• Name: spectrin beta, erythrocytic; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6367831
• Gene: Sptb Location: Chr12:76627262-76757321 bp, - strand Genetic Position: Chr12, 33.73 cM
• Alliance: Sptb^em1(IMPC)J page
• IMPC: Sptb gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATTGGGATACAGGAAGAG and CCCACCACACTTCAGAAATG, which resulted in a 1369 bp deletion beginning at Chromosome 12 position 76,620,406 bp and ending after 76,621,774 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000114246 (exon 14) and 398 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 599 and early truncation 7 amino acids later. There is a 2 bp insertion (AC) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Sptb Mutation: 85 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)