Gtpbp4^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gtpbp4^em1(IMPC)Tcp
• Name: GTP binding protein 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6362818
• Synonyms: Gtpbp4^-
• Gene: Gtpbp4 Location: Chr13:9016367-9046119 bp, - strand Genetic Position: Chr13, 3.64 cM, cytoband A1
• Alliance: Gtpbp4^em1(IMPC)Tcp page
• IMPC: Gtpbp4 gene page

Gtpbp4^em1(IMPC)Tcp/Gtpbp4^em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts fail to hatch from the zona pellucida and die after 3 days in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences AAAGGGAGCTGCTTCTCCGG and GGGTTCTCATGATAGCTTAG that targeted exon(s) ENSMUSE00000115082.2 ENSMUSE00000115106.2. This resulted in deletion(s) of 9 bp (location: Chr13:9041472-9041480; GRCm39), 816 bp (location: Chr13:9041490-9042305; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gtpbp4 Mutation: 35 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)