Rwdd2a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rwdd2a^em1(IMPC)J
• Name: RWD domain containing 2A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6361969
• Gene: Rwdd2a Location: Chr9:86454044-86456952 bp, + strand Genetic Position: Chr9, 46.58 cM
• Alliance: Rwdd2a^em1(IMPC)J page
• IMPC: Rwdd2a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACTGCATACGTTGTTCAG and CTGGTATGAGACATTAATGT, which resulted in a 1308 bp deletion beginning at Chromosome 9 position 86,573,848 bp and ending after 86,575,155 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219614 (exon 3) and 382 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 17 amino acids later. There is an 8 bp (CGAGATAT) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rwdd2a Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)