About   Help   FAQ
Slc36a4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc36a4em1(IMPC)J
Name: solute carrier family 36 (proton/amino acid symporter), member 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6361107
Gene: Slc36a4  Location: Chr9:15621034-15653684 bp, + strand  Genetic Position: Chr9, 5.12 cM
Alliance: Slc36a4em1(IMPC)J page
IMPC: Slc36a4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CACATCAGTTTTACCAGCAG and CCAAATGCTGTGTCCCTCAG, which resulted in a 365 bp deletion beginning at Chromosome 9 position 15,719,595 bp and ending after 15,719,959 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000341746 (exon 2) and 241 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc36a4 Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory