About   Help   FAQ
Gykl1em2Juhu
Endonuclease-mediated Allele Detail
Summary
Symbol: Gykl1em2Juhu
Name: glycerol kinase-like 1; endonuclease-mediated mutation 2, Junjiu Huang
MGI ID: MGI:6359762
Synonyms: Gykl1-, Gykl1 KO
Gene: Gykl1  Location: Chr18:52826762-52828622 bp, + strand  Genetic Position: Chr18, 28.25 cM
Alliance: Gykl1em2Juhu page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsAn insertion of 236 bp was created using an sgRNA (AGCGGGAAACTACGATAGTC) and CRISPR/Cas9 technology, creating a null allele. (J:278636)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gykl1 Mutation:  12 strains or lines available
References
Original:  J:278636 Chen Y, et al., Glycerol kinase-like proteins cooperate with Pld6 in regulating sperm mitochondrial sheath formation and male fertility. Cell Discov. 2017;3:17030
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory