Gykl1^em2Juhu
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gykl1^em2Juhu
• Name: glycerol kinase-like 1; endonuclease-mediated mutation 2, Junjiu Huang
• MGI ID: MGI:6359762
• Synonyms: Gykl1^-, Gykl1 KO
• Gene: Gykl1 Location: Chr18:52826762-52828622 bp, + strand Genetic Position: Chr18, 28.25 cM
• Alliance: Gykl1^em2Juhu page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: An insertion of 236 bp was created using an sgRNA (AGCGGGAAACTACGATAGTC) and CRISPR/Cas9 technology, creating a null allele. (J:278636)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gykl1 Mutation: 12 strains or lines available

References

• Original: J:278636 Chen Y, et al., Glycerol kinase-like proteins cooperate with Pld6 in regulating sperm mitochondrial sheath formation and male fertility. Cell Discov. 2017;3:17030
• All: 1 reference(s)