Nat14^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nat14^em1(IMPC)J
• Name: N-acetyltransferase 14; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6357930
• Gene: Nat14 Location: Chr7:4925027-4928005 bp, + strand Genetic Position: Chr7, 2.85 cM
• Alliance: Nat14^em1(IMPC)J page
• IMPC: Nat14 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAAAGACACGGAAAACCGTG and CATGGGCTATATGCTGGTTA, which resulted in a 510 bp deletion beginning at Chromosome 7 position 4,923,920 bp and ending after 4,924,429 bp (GRCm38/mm10). This mutation deletes 510 bp of ENSMUSE00000494728 (exon 3) and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nat14 Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)