About   Help   FAQ
AI467606em1Ciphe
Endonuclease-mediated Allele Detail
Summary
Symbol: AI467606em1Ciphe
Name: expressed sequence AI467606; endonuclease-mediated mutation 1, Centre d'ImmunoPhenomique
MGI ID: MGI:6357866
Gene: AI467606  Location: Chr7:126690531-126693158 bp, + strand  Genetic Position: Chr7, 69.32 cM
Alliance: AI467606em1Ciphe page
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 2 was targeted with sgRNAs (targeting GCTCCCTGAGCCTACAGCGGAGG and AGCGTGCCCCCACCCTAGTCTGG) using CRISPR/Cas9 technology, resulting in a 197 bp deletion in the 5' end of the CDS in exon 2. (J:82809, J:282407)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any AI467606 Mutation:  13 strains or lines available
References
Original:  J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory