Klhdc10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klhdc10^em1(IMPC)J
• Name: kelch domain containing 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6357835
• Gene: Klhdc10 Location: Chr6:30401867-30455178 bp, + strand Genetic Position: Chr6, 12.52 cM, cytoband A3
• Alliance: Klhdc10^em1(IMPC)J page
• IMPC: Klhdc10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGATGGATCTCTCTCACA and ACAAGGCAAGCGCACAGCCG, which resulted in a 365 bp deletion beginning at Chromosome 6 position 30,441,596 bp and ending after 30,441,960 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001221353 (exon 4) and 210 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 155 and early truncation 20 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Klhdc10 Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)