Rr125^em1Tmhm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr125^em1Tmhm
• Name: regulatory region 125; endonuclease-mediated mutation 1, Tim Mohun
• MGI ID: MGI:6356016
• Synonyms: Furin^deltaM10, Furin^em1Tmhm
• Gene: Rr125 Location: unknown Genetic Position: Chr7, Syntenic
• Alliance: Rr125^em1Tmhm page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: NKX2-5 binding enhancer M10, upstream of Furin, was targeted with two sgRNAs (targeting ATGCGGTTGTGATCTCTCGG and GCCACCGGCAAAGGCGTGGT) using CRISPR/Cas9 technology, resulting in an 896 bp deletion in line 676. (J:273415)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr125 Mutation: 0 strains or lines available

References

• Original: J:273415 Dupays L, et al., Furin, a transcriptional target of NKX2-5, has an essential role in heart development and function. PLoS One. 2019;14(3):e0212992
• All: 1 reference(s)