Gje1^em3(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gje1^em3(IMPC)H
• Name: gap junction protein, epsilon 1; endonuclease-mediated mutation 3, Harwell
• MGI ID: MGI:6355935
• Gene: Gje1 Location: Chr10:14591367-14593958 bp, - strand Genetic Position: Chr10, 5.5 cM, cytoband A2
• Alliance: Gje1^em3(IMPC)H page
• IMPC: Gje1 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences GCCAGAATGCGAACACCTCCAGG, CCAGAATGCGAACACCTCCAGGC, GGTTTATCTCTCGCTTGTCTGGG, AGGTTTATCTCTCGCTTGTCTGG, which resulted in an intragenic deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gje1 Mutation: 25 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)