About   Help   FAQ
Glaem2(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Glaem2(IMPC)H
Name: galactosidase, alpha; endonuclease-mediated mutation 2, Harwell
MGI ID: MGI:6355923
Gene: Gla  Location: ChrX:133488912-133501707 bp, - strand  Genetic Position: ChrX, 56.2 cM, cytoband E-F1
Alliance: Glaem2(IMPC)H page
IMPC: Gla gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 4 guide sequences TCTCACTTGTCCATCTGGTTTGG, GCTATTGAGGAGACCAAAACCGG, ATTGAGGAGACCAAAACCGGAGG, TACGGTCTCACTTGTCCATCTGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gla Mutation:  21 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory