Eepd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eepd1^em1(IMPC)J
• Name: endonuclease/exonuclease/phosphatase family domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342819
• Gene: Eepd1 Location: Chr9:25392843-25515406 bp, + strand Genetic Position: Chr9, 10.25 cM, cytoband A4
• Alliance: Eepd1^em1(IMPC)J page
• IMPC: Eepd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACAGGTCCGAGGGATCTCT and GGTGGTGTGCATGACGCTTC, which resulted in a 661 bp deletion beginning at Chromosome 9 position 25,482,477 bp and ending after 25,483,137 bp (GRCm38/mm10). This mutation deletes 661 bp of ENSMUSE00000410963 (exon 2) and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 11 amino acids later. There is a 4 bp deletion (GCTT) 166 bp downstream of the 661 bp deletion. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eepd1 Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)