Slc4a1apem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Slc4a1apem1(IMPC)J |
Name: |
solute carrier family 4 (anion exchanger), member 1, adaptor protein; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6342514 |
Gene: |
Slc4a1ap Location: Chr5:31684339-31714276 bp, + strand Genetic Position: Chr5, 17.27 cM
|
Alliance: |
Slc4a1apem1(IMPC)J page
|
IMPC: |
Slc4a1ap gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTTCCAGGAGGTGATCCC and CCAGTGCTATTAAGCTACCA, which resulted in a 391 bp deletion beginning at Chromosome 5 position 31,531,863 bp and ending after 31,532,253 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001226900 (exon 4) and 330 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 328 and early truncation 2 amino acids later. There is a single bp insertion (A) at the deletion site.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|