Pcdhb9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcdhb9^em1(IMPC)J
• Name: protocadherin beta 9; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342494
• Gene: Pcdhb9 Location: Chr18:37533908-37536962 bp, + strand Genetic Position: Chr18, 19.48 cM, cytoband B3
• Alliance: Pcdhb9^em1(IMPC)J page
• IMPC: Pcdhb9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGGTGAAGATTCCTCCAAAG and TATGGAAAGTCCCCACTGCA, which resulted in a 2432 bp deletion beginning at Chromosome 18 position 37,400,984 bp and ending after 37,403,415 bp (GRCm38/mm10). This mutation internally deletes 2433 bp from ENSMUSE00000413638 (exon 1) and is predicted to cause a change of amino acid sequence after residue 10, a loss of 813 amino acids, returning into frame 7 amino acids before the termination. There is a 1 bp deletion (C) 3 bp before the 2432 bp deletion. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pcdhb9 Mutation: 52 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)