Prss35^{em1(IMPC)Ccpcz}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prss35^{em1(IMPC)Ccpcz}
• Name: serine protease 35; endonuclease-mediated mutation 1, Institute of Molecular Genetics
• MGI ID: MGI:6341954
• Gene: Prss35 Location: Chr9:86625702-86640496 bp, + strand Genetic Position: Chr9, 46.58 cM
• Alliance: Prss35^{em1(IMPC)Ccpcz} page
• IMPC: Prss35 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Czech centre for Phenogenomics by injecting CAS9 Protein and 2 guide sequences CCTTGGACTACGACTACGCGCTC, CCATCTTCGAGAATGGCACCCGA, which resulted in an intergenic deletion. (J:237616)

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Prss35 Mutation: 30 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)