Park7^em2(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Park7^em2(IMPC)H
• Name: Parkinson disease (autosomal recessive, early onset) 7; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:6336218
• Gene: Park7 Location: Chr4:150981590-150994378 bp, - strand Genetic Position: Chr4, 81.52 cM, cytoband E1
• Alliance: Park7^em2(IMPC)H page
• IMPC: Park7 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences GGAAGAACCACCACATCGTATGG, CTGGACAAATCATTACATCACGG, CCTCCTGGAAGAACCACCACATC, CATCACGGCTACACTGCACGGGG, which resulted in an intragenic deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Park7 Mutation: 56 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)