About   Help   FAQ
Dnah8em1(IMPC)Ics
Endonuclease-mediated Allele Detail
Summary
Symbol: Dnah8em1(IMPC)Ics
Name: dynein, axonemal, heavy chain 8; endonuclease-mediated mutation 1, Mouse Clinical Institute
MGI ID: MGI:6336150
Gene: Dnah8  Location: Chr17:30845909-31094736 bp, + strand  Genetic Position: Chr17, 15.71 cM
Alliance: Dnah8em1(IMPC)Ics page
IMPC: Dnah8 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Institut Clinique de la Souris by injecting CAS9 RNA and 4 guide sequences CAGCTGATAGGGCGTGCCATGGG, CCCCGAGACTTTCCATTGTTTGG, TCCATCCCCCAGGCTTTCATGGG, AGCTTAGCAATCTAGATGATGGG, which resulted in a Exon Deletion. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dnah8 Mutation:  262 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory