Dnah8^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnah8^em1(IMPC)Ics
• Name: dynein, axonemal, heavy chain 8; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:6336150
• Gene: Dnah8 Location: Chr17:30845909-31094736 bp, + strand Genetic Position: Chr17, 15.71 cM
• Alliance: Dnah8^em1(IMPC)Ics page
• IMPC: Dnah8 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Institut Clinique de la Souris by injecting CAS9 RNA and 4 guide sequences CAGCTGATAGGGCGTGCCATGGG, CCCCGAGACTTTCCATTGTTTGG, TCCATCCCCCAGGCTTTCATGGG, AGCTTAGCAATCTAGATGATGGG, which resulted in a Exon Deletion. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Dnah8 Mutation: 261 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 1 reference(s)