Dnah8em1(IMPC)Ics
Endonuclease-mediated Allele Detail
|
Symbol: |
Dnah8em1(IMPC)Ics |
Name: |
dynein, axonemal, heavy chain 8; endonuclease-mediated mutation 1, Mouse Clinical Institute |
MGI ID: |
MGI:6336150 |
Gene: |
Dnah8 Location: Chr17:30845909-31094736 bp, + strand Genetic Position: Chr17, 15.71 cM
|
Alliance: |
Dnah8em1(IMPC)Ics page
|
IMPC: |
Dnah8 gene page |
|
Strain of Origin: |
C57BL/6N
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from IMPC was generated at Institut Clinique de la Souris by injecting CAS9 RNA and 4 guide sequences CAGCTGATAGGGCGTGCCATGGG, CCCCGAGACTTTCCATTGTTTGG, TCCATCCCCCAGGCTTTCATGGG, AGCTTAGCAATCTAGATGATGGG, which resulted in a Exon Deletion.
(J:237616)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Dnah8 Mutation: |
261 strains or lines available
|
|
Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
All: |
1 reference(s) |
|