Xirp1em1(IMPC)Ics
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Xirp1em1(IMPC)Ics |
| Name: |
xin actin-binding repeat containing 1; endonuclease-mediated mutation 1, Mouse Clinical Institute |
| MGI ID: |
MGI:6336098 |
| Gene: |
Xirp1 Location: Chr9:119842821-119852660 bp, - strand Genetic Position: Chr9, 71.36 cM
|
| Alliance: |
Xirp1em1(IMPC)Ics page
|
| IMPC: |
Xirp1 gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Institut Clinique de la Souris using Cas9 and guides with spacer sequences ATGTGGGAGCCCCTTAGTAG, GGCTCACGATACCCCGGCCT, GGGGCTCTTTTTCAGAAGGC, and TGGGTTAACTAGCACGAGAA that targeted exon(s) ENSMUSE00000688580.3 ENSMUSE00001463382.3. This resulted in deletion(s) of 3607 bp (location: Chr9:119845370-119848976; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
2 reference(s) |
|