Lca5l^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lca5l^em1(IMPC)Ics
• Name: Leber congenital amaurosis 5-like; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:6336078
• Gene: Lca5l Location: Chr16:95959605-95993450 bp, - strand Genetic Position: Chr16, 56.84 cM
• Alliance: Lca5l^em1(IMPC)Ics page
• IMPC: Lca5l gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Institut Clinique de la Souris using Cas9 and guides with spacer sequences AGACATGAAATAGATGCAAC, AGGAGCACACGTGTTAGAGC, CATTGCTCTCTTACCAATAC, and TGCCTCTCTCTGTGCACTAC that targeted exon(s) ENSMUSE00001220131.2. This resulted in deletion(s) of 835 bp (location: Chr16:95976818-95977652; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Lca5l Mutation: 36 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)