Clhc1^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Clhc1^em1(IMPC)Ics
• Name: clathrin heavy chain linker domain containing 1; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:6336068
• Gene: Clhc1 Location: Chr11:29497950-29528360 bp, + strand Genetic Position: Chr11, 16.79 cM, cytoband A4
• Alliance: Clhc1^em1(IMPC)Ics page
• IMPC: Clhc1 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Institut Clinique de la Souris using Cas9 and guides with spacer sequences ACCCATGGAGAGCATATGCT, CAGAGCTAGCTGAATTCACC, CTAGAAAAGTGTCATGCTAC, and TACACAAACTCAACATGAGT that targeted exon(s) ENSMUSE00000104969.2 ENSMUSE00001378159.2. This resulted in deletion(s) of 57 bp (location: Chr11:29505839-29505895; GRCm39), 555 bp (location: Chr11:29505927-29506481; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Clhc1 Mutation: 51 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 2 reference(s)