Ist1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Ist1em1(IMPC)J |
Name: |
increased sodium tolerance 1 homolog (yeast); endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6331113 |
Gene: |
Ist1 Location: Chr8:110397957-110419892 bp, - strand Genetic Position: Chr8, 57.18 cM
|
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC |
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATCTTGTACACAAGCTTC and AGGGGAGTAGATGTGCTAAG, which resulted in a 978 bp deletion beginning at Chromosome 8 position 109,681,965 bp and ending after 109,682,942 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000212413 and ENSMUSE00000212415 (exons 3 and 4) and 709 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 29and early truncation 26 amino acids later. There is a 7 bp intronic deletion 96 bp before the larger deletion.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|