About   Help   FAQ
Ist1em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Ist1em1(IMPC)J
Name: increased sodium tolerance 1 homolog (yeast); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6331113
Gene: Ist1  Location: Chr8:110397957-110419892 bp, - strand  Genetic Position: Chr8, 57.18 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATCTTGTACACAAGCTTC and AGGGGAGTAGATGTGCTAAG, which resulted in a 978 bp deletion beginning at Chromosome 8 position 109,681,965 bp and ending after 109,682,942 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000212413 and ENSMUSE00000212415 (exons 3 and 4) and 709 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 29and early truncation 26 amino acids later. There is a 7 bp intronic deletion 96 bp before the larger deletion. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ist1 Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/03/2022
MGI 6.19
The Jackson Laboratory