Polr3b^em5Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr3b^em5Tcp
• Name: polymerase (RNA) III (DNA directed) polypeptide B; endonuclease-mediated mutation 5, The Centre for Phenogenomics
• MGI ID: MGI:6323011
• Gene: Polr3b Location: Chr10:84458156-84563042 bp, + strand Genetic Position: Chr10, 41.58 cM, cytoband C1
• Alliance: Polr3b^em5Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Nucleotide substitutions
• Mutation details: This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with a single guide RNA with the spacer sequence TCATGTCCCTCAGACGGCAC resulting in two SNV changes C>T at Chr10:84632451 to disrupt PAM (within intron) and G>A at Chr10:84632459 which is predicted to result in a p.R103H change (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Polr3b Mutation: 100 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)