Polr3bem4Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Polr3bem4Tcp |
| Name: |
polymerase (RNA) III (DNA directed) polypeptide B; endonuclease-mediated mutation 4, The Centre for Phenogenomics |
| MGI ID: |
MGI:6323010 |
| Gene: |
Polr3b Location: Chr10:84458156-84563042 bp, + strand Genetic Position: Chr10, 41.58 cM, cytoband C1
|
| Alliance: |
Polr3bem4Tcp page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribnucleoprotein complexes with a single guide RNA having spacer sequences TCATGTCCCTCAGACGGCAC along with a single-strand oligonucleotide repair template. Homology-directed repair resulted in c.308G>A at Chromosome 10 positive strand 84632459 bp (GRCm38) and is predicted to cause p.R103H.
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
2 reference(s) |
|