Polr3b^em4Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr3b^em4Tcp
• Name: polymerase (RNA) III (DNA directed) polypeptide B; endonuclease-mediated mutation 4, The Centre for Phenogenomics
• MGI ID: MGI:6323010
• Gene: Polr3b Location: Chr10:84458156-84563042 bp, + strand Genetic Position: Chr10, 41.58 cM, cytoband C1
• Alliance: Polr3b^em4Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Single point mutation
• Mutation details: This allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribnucleoprotein complexes with a single guide RNA having spacer sequences TCATGTCCCTCAGACGGCAC along with a single-strand oligonucleotide repair template. Homology-directed repair resulted in c.308G>A at Chromosome 10 positive strand 84632459 bp (GRCm38) and is predicted to cause p.R103H. (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Polr3b Mutation: 100 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 2 reference(s)