About   Help   FAQ
Polr3bem4Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Polr3bem4Tcp
Name: polymerase (RNA) III (DNA directed) polypeptide B; endonuclease-mediated mutation 4, The Centre for Phenogenomics
MGI ID: MGI:6323010
Gene: Polr3b  Location: Chr10:84458156-84563042 bp, + strand  Genetic Position: Chr10, 41.58 cM, cytoband C1
Alliance: Polr3bem4Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Single point mutation
 
Mutation detailsThis allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribnucleoprotein complexes with a single guide RNA having spacer sequences TCATGTCCCTCAGACGGCAC along with a single-strand oligonucleotide repair template. Homology-directed repair resulted in c.308G>A at Chromosome 10 positive strand 84632459 bp (GRCm38) and is predicted to cause p.R103H. (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Polr3b Mutation:  100 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory