About   Help   FAQ
Polr3bem3(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Polr3bem3(IMPC)Tcp
Name: polymerase (RNA) III (DNA directed) polypeptide B; endonuclease-mediated mutation 3, The Centre for Phenogenomics
MGI ID: MGI:6323008
Gene: Polr3b  Location: Chr10:84458156-84563042 bp, + strand  Genetic Position: Chr10, 41.58 cM, cytoband C1
Alliance: Polr3bem3(IMPC)Tcp page
IMPC: Polr3b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0233 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with a single guide RNA with the spacer sequence TCATGTCCCTCAGACGGCAC resulting in a 5-bp deletion on Chr10 from 84632454 to 84632458_delGTGCC (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Polr3b Mutation:  100 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory