About   Help   FAQ
Pstpip2em3b(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Pstpip2em3b(IMPC)Tcp
Name: proline-serine-threonine phosphatase-interacting protein 2; endonuclease-mediated mutation 3b, The Centre for Phenogenomics
MGI ID: MGI:6323007
Gene: Pstpip2  Location: Chr18:77882250-77971462 bp, + strand  Genetic Position: Chr18, 52.38 cM, cytoband E3
Alliance: Pstpip2em3b(IMPC)Tcp page
IMPC: Pstpip2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0319 was generated at The Centre for Phenogenomics by injecting Cas9 D10A endonuclease (nickase) mRNA and four guide RNAs with spacer sequences of TCCACATTTTGCTCGGCTCA and CTGCGTTTTACCTTCCCCAA targeting the 5' side and GTACAGATTCATGGGCCCAC and GCAGGCGGGTGTGAAGCATC targeting the 3' side of exon ENMUSE00000514786 resulting in a 571 bp deletion of Chr18 from 77847863 to 77848434 and a 21 bp del of Chr18 from 77848578 to 77848599 with insGA (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pstpip2 Mutation:  25 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory