Pstpip2^{em3b(IMPC)Tcp}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pstpip2^{em3b(IMPC)Tcp}
• Name: proline-serine-threonine phosphatase-interacting protein 2; endonuclease-mediated mutation 3b, The Centre for Phenogenomics
• MGI ID: MGI:6323007
• Gene: Pstpip2 Location: Chr18:77882250-77971462 bp, + strand Genetic Position: Chr18, 52.38 cM, cytoband E3
• Alliance: Pstpip2^{em3b(IMPC)Tcp} page
• IMPC: Pstpip2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0319 was generated at The Centre for Phenogenomics by injecting Cas9 D10A endonuclease (nickase) mRNA and four guide RNAs with spacer sequences of TCCACATTTTGCTCGGCTCA and CTGCGTTTTACCTTCCCCAA targeting the 5' side and GTACAGATTCATGGGCCCAC and GCAGGCGGGTGTGAAGCATC targeting the 3' side of exon ENMUSE00000514786 resulting in a 571 bp deletion of Chr18 from 77847863 to 77848434 and a 21 bp del of Chr18 from 77848578 to 77848599 with insGA (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pstpip2 Mutation: 25 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)