About   Help   FAQ
Ano6em2Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ano6em2Tcp
Name: anoctamin 6; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6323004
Gene: Ano6  Location: Chr15:95688724-95872632 bp, + strand  Genetic Position: Chr15, 50.66 cM
Alliance: Ano6em2Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Modified isoform(s))
Mutation:    Nucleotide substitutions
 
Mutation detailsThis allele from project TCPR0236 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein with a single guide RNA with spacer sequence GGATCGGGTCTGTCCCGTTG along with a single-strand oligonucleotide repair template. Homology-directed repair resulted in c.1476C>T, a silent coding change disrupting the PAM sequence, and c.1483G>C that is predicted to cause p.G495R. These changes are at Chromosome 15 positive strand 95948358 bp and 95948365 bp (GRCm38), respectively. (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ano6 Mutation:  83 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory