Ano6^em2Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ano6^em2Tcp
• Name: anoctamin 6; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6323004
• Gene: Ano6 Location: Chr15:95688724-95872632 bp, + strand Genetic Position: Chr15, 50.66 cM
• Alliance: Ano6^em2Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Nucleotide substitutions
• Mutation details: This allele from project TCPR0236 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein with a single guide RNA with spacer sequence GGATCGGGTCTGTCCCGTTG along with a single-strand oligonucleotide repair template. Homology-directed repair resulted in c.1476C>T, a silent coding change disrupting the PAM sequence, and c.1483G>C that is predicted to cause p.G495R. These changes are at Chromosome 15 positive strand 95948358 bp and 95948365 bp (GRCm38), respectively. (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ano6 Mutation: 83 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)