About   Help   FAQ
Ano6em1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Ano6em1Tcp
Name: anoctamin 6; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6323003
Gene: Ano6  Location: Chr15:95688724-95872632 bp, + strand  Genetic Position: Chr15, 50.66 cM
Alliance: Ano6em1Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Single point mutation
 
Mutation detailsThis allele from project TCPR0240 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and a single guide RNA with spacer sequence GGATCGGGTCTGTCCCGTTG along with a single-strand oligonucleotide repair template. Homology-directed repair resulted in c.1483G>C that is predicted to cause p.G495R at Chromosome 15 95948365 bp (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ano6 Mutation:  84 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory