Spag6l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spag6l^em1(IMPC)J
• Name: sperm associated antigen 6-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6322959
• Gene: Spag6l Location: Chr16:16570880-16647177 bp, - strand Genetic Position: Chr16, 10.39 cM
• Alliance: Spag6l^em1(IMPC)J page
• IMPC: Spag6l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at The Jackson Laboratory by injecting CAS9 Protein and 2 guide sequences CTAGGTTAGTTACTAACCAGCGG, AGGGAATCTGAAGGAGACGGTGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Spag6l Mutation: 54 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 1 reference(s)