About   Help   FAQ
Plcg2em1Msasn
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Plcg2em1Msasn
Name: phospholipase C, gamma 2; endonuclease-mediated mutation 1, Michael Sasner
MGI ID: MGI:6316314
Synonyms: Plcg2P522R, Plcg2R522
Gene: Plcg2  Location: Chr8:118225030-118361881 bp, + strand  Genetic Position: Chr8, 64.26 cM
Mutation
origin
Strain of Origin:  B6(SJL)-Apoetm1.1(APOE*4)Adiuj/J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsA C-to-G mutation was engineered in proline codon 522 (CCC) to change it to an arginine codon (CGC) (c.1565C>G, p.P522R) with an sgRNA (targeting CCAAAATGCAGCTCCGTGGG) and an ssODN template (GAGCTGTAATAAGCCCTTTCGGATGCTTGTGGCTCAGGACACTCGCCCCACGGAGCTGCATTTTGGGGAGAAATGGTTCCACA) using CRISPR/Cas9 technology. The mutation models a human SNP that was identified in a whole exome chip of rare SNPs associated with Alzheimer's disease and has been associated with protection from Alzheimer's disease. (J:101977, J:308279)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Plcg2 Mutation:  50 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/30/2021
MGI 6.17
The Jackson Laboratory