Nek2^em3(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nek2^em3(IMPC)Tcp
• Name: NIMA (never in mitosis gene a)-related expressed kinase 2; endonuclease-mediated mutation 3, The Centre for Phenogenomics
• MGI ID: MGI:6316309
• Gene: Nek2 Location: Chr1:191553622-191565161 bp, + strand Genetic Position: Chr1, 96.94 cM
• Alliance: Nek2^em3(IMPC)Tcp page
• IMPC: Nek2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPC309 was generated at The Centre for Phenogenomics by injecting Cas9D10A mRNA and guide RNAs with spacer sequences GGTCCCGGTGAAGCACAGTG and CAGCAAACACAATGTCAAGC, which resulted in an 8-bp deletion CTTCACCG in Chromosome 1 positive strand 191822588 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. c.412_419delCTTCACCG; p.(L138Gfs*22) (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nek2 Mutation: 25 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)