About   Help   FAQ
Nek2em3(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Nek2em3(IMPC)Tcp
Name: NIMA (never in mitosis gene a)-related expressed kinase 2; endonuclease-mediated mutation 3, The Centre for Phenogenomics
MGI ID: MGI:6316309
Gene: Nek2  Location: Chr1:191553622-191565161 bp, + strand  Genetic Position: Chr1, 96.94 cM
Alliance: Nek2em3(IMPC)Tcp page
IMPC: Nek2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPC309 was generated at The Centre for Phenogenomics by injecting Cas9D10A mRNA and guide RNAs with spacer sequences GGTCCCGGTGAAGCACAGTG and CAGCAAACACAATGTCAAGC, which resulted in an 8-bp deletion CTTCACCG in Chromosome 1 positive strand 191822588 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. c.412_419delCTTCACCG; p.(L138Gfs*22) (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nek2 Mutation:  25 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory