Zfp91em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Zfp91em2(IMPC)Tcp |
| Name: |
zinc finger protein 91; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316232 |
| Gene: |
Zfp91 Location: Chr19:12744384-12773490 bp, - strand Genetic Position: Chr19, 8.73 cM
|
| Alliance: |
Zfp91em2(IMPC)Tcp page
|
| IMPC: |
Zfp91 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0787 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GCTATGAGTGTACCCTTGCT and AAAATTGGCATAGCCCCCAT targeting the 5' side and TCAAGCATACCTTTCAAGGT and GGTTTAATAGATCAAATGGA targeting the 3' side of exons ENSMUSE00001230146, ENSMUSE00001252442, and ENSMUSE00001304574 (exons 3-5) resulting in a 1,436-bp deletion of Chr19 from 12777799 to 12779234 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|