About   Help   FAQ
Wnk3em3(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Wnk3em3(IMPC)Tcp
Name: WNK lysine deficient protein kinase 3; endonuclease-mediated mutation 3, The Centre for Phenogenomics
MGI ID: MGI:6316231
Gene: Wnk3  Location: ChrX:149981074-150103148 bp, + strand  Genetic Position: ChrX, 68.46 cM
Alliance: Wnk3em3(IMPC)Tcp page
IMPC: Wnk3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Insertion
 
Mutation detailsThis allele from project TCPR0565 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and a single guide RNA with a spacer sequence of ATTTCAGCGGGGTCGGTTCC along with a lacZ target vector. The lacZ was not incorporated into the allele and instead non-homologous end-joining repair resulted in an indel at ChrX:151294546-151294547_delGT (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Wnk3 Mutation:  14 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory