About   Help   FAQ
Vps37aem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Vps37aem1(IMPC)Tcp
Name: vacuolar protein sorting 37A; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6316230
Gene: Vps37a  Location: Chr8:40964824-41003798 bp, + strand  Genetic Position: Chr8, 23.89 cM, cytoband B1.2
Alliance: Vps37aem1(IMPC)Tcp page
IMPC: Vps37a gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1166 was generated at The Centre for Phenogenomics by electroporation of Cpf1 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTATTCTCGTGTTATTCCTT targeting the 5' side and CCTGGAGAATACTGTTTACTT targeting the 3' side leading to the deletion of 257-bp on Chr8 from 40528311 to 40528567 (GRCm38) deleting a critical exon and resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Vps37a Mutation:  13 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory