Upf3b^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Upf3b^em2(IMPC)Tcp
• Name: UPF3 regulator of nonsense transcripts homolog B (yeast); endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316229
• Gene: Upf3b Location: ChrX:36355331-36373975 bp, - strand Genetic Position: ChrX, 21.51 cM, cytoband A2
• Alliance: Upf3b^em2(IMPC)Tcp page
• IMPC: Upf3b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0565 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GGAGATCACTTAGTTGGCCT and ATGGCATTTCTTCTACTATA targeting the 5' side and TTATTCACTGCGAACTAATA and TATATCCCCTGAGGCTGTCA targeting the 3' side of exons ENSMUSE00001311515 and ENSMUSE00001291484 resulting in a 2,466-bp deletion of ChrX from 37099869 to 37102334 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Upf3b Mutation: 10 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)