About   Help   FAQ
Upf3bem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Upf3bem2(IMPC)Tcp
Name: UPF3 regulator of nonsense transcripts homolog B (yeast); endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316229
Gene: Upf3b  Location: ChrX:36355331-36373975 bp, - strand  Genetic Position: ChrX, 21.51 cM, cytoband A2
Alliance: Upf3bem2(IMPC)Tcp page
IMPC: Upf3b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details

This allele from project TCPR0565 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GGAGATCACTTAGTTGGCCT and ATGGCATTTCTTCTACTATA targeting the 5' side and TTATTCACTGCGAACTAATA and TATATCCCCTGAGGCTGTCA targeting the 3' side of exons ENSMUSE00001311515 and ENSMUSE00001291484 resulting in a 2,466-bp deletion of ChrX from 37099869 to 37102334 (GRCm38). (J:200814)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Upf3b Mutation:  10 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory