Trh^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trh^em2(IMPC)Tcp
• Name: thyrotropin releasing hormone; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316227
• Gene: Trh Location: Chr6:92219042-92221631 bp, - strand Genetic Position: Chr6, 41.03 cM
• Alliance: Trh^em2(IMPC)Tcp page
• IMPC: Trh gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0430 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCAAGAATCGACGTTCTGGC and GCTTTGATCTTCGTGCTAAC targeting the 5' side and CAGATGCCCCCCAAGTCAAG and GGATCTATGAACCTCCGGCC targeting the 3' side of the target region resulting in a 958-bp deletion of Chr6 from 92242876 to 92243833 with 1-bp insertion of A and a 4-bp deletion from 92242807 to 92242810 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 16 and early truncation 24 amino acids later (p.L16Qfs*26). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Trh Mutation: 23 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)