About   Help   FAQ
Trhem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Trhem2(IMPC)Tcp
Name: thyrotropin releasing hormone; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316227
Gene: Trh  Location: Chr6:92219042-92221631 bp, - strand  Genetic Position: Chr6, 41.03 cM
Alliance: Trhem2(IMPC)Tcp page
IMPC: Trh gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0430 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TCAAGAATCGACGTTCTGGC and GCTTTGATCTTCGTGCTAAC targeting the 5' side and CAGATGCCCCCCAAGTCAAG and GGATCTATGAACCTCCGGCC targeting the 3' side of the target region resulting in a 958-bp deletion of Chr6 from 92242876 to 92243833 with 1-bp insertion of A and a 4-bp deletion from 92242807 to 92242810 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 16 and early truncation 24 amino acids later (p.L16Qfs*26). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Trh Mutation:  23 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory