Top2aem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Top2aem1(IMPC)Tcp |
| Name: |
topoisomerase (DNA) II alpha; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316226 |
| Gene: |
Top2a Location: Chr11:98883769-98915015 bp, - strand Genetic Position: Chr11, 62.91 cM
|
| Alliance: |
Top2aem1(IMPC)Tcp page
|
| IMPC: |
Top2a gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0590 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GCCCTGCATAAGAACATGGG and GTCAGCATGTATTTTGGGTC targeting the 5' side and TTTGAGTTAGAGTGCAGTAT and ATGCCTGTGCCTGATCTGAC targeting the 3' side of exons ENSMUSE00000648121 (exon 6), ENSMUSE00000648120 (exon 7), ENSMUSE00000648119 (exon 8), ENSMUSE00000648118 (exon 9), and ENSMUSE00000648117 (exon 10) resulting in a 2,985-bp deletion of Chr11 from 99014015 to 99016999 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|