About   Help   FAQ
Tmem65em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem65em1(IMPC)Tcp
Name: transmembrane protein 65; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6316224
Gene: Tmem65  Location: Chr15:58654118-58695487 bp, - strand  Genetic Position: Chr15, 25.09 cM
Alliance: Tmem65em1(IMPC)Tcp page
IMPC: Tmem65 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1187 was generated at The Centre for Phenogenomics by injecting Cpf1 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of CCAGCATAACTCCTGTCAAGTAA targeting the 5' side and AGTAAAGAAATTAGTGTGCTCTA targeting the 3' side of a critical exon. This resulted in a 242-bp deletion Chr15:58794295 to 58794536 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tmem65 Mutation:  16 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory