Tmem65^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem65^em1(IMPC)Tcp
• Name: transmembrane protein 65; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6316224
• Gene: Tmem65 Location: Chr15:58654118-58695487 bp, - strand Genetic Position: Chr15, 25.09 cM
• Alliance: Tmem65^em1(IMPC)Tcp page
• IMPC: Tmem65 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cpf1 and guides with spacer sequences AGTAAAGAAATTAGTGTGCTC and CCAGCATAACTCCTGTCAAGT that targeted exon(s) ENSMUSE00000457702.4. This resulted in deletion(s) of 242 bp (location: Chr15:58666144-58666385; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem65 Mutation: 16 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 4 reference(s)