Tmem209em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tmem209em2(IMPC)Tcp |
| Name: |
transmembrane protein 209; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316223 |
| Gene: |
Tmem209 Location: Chr6:30480806-30509786 bp, - strand Genetic Position: Chr6, 12.52 cM
|
| Alliance: |
Tmem209em2(IMPC)Tcp page
|
| IMPC: |
Tmem209 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0448 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ATGGCTCGCTAGTAAGCTAG and CATCTGCCACTCTAATTAAG targeting the 5' side and GGTCACCAGCTGGTTTCAGC and TCACACCTGGGATCCTCATG targeting the 3' side of exons ENSMUSE00001236619 (exon 4) and ENSMUSE00001262606 (exon 5) resulting in a 2198 bp deletion of Chr6 from 30505363 to 30507560 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|