Tmem209^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem209^em2(IMPC)Tcp
• Name: transmembrane protein 209; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316223
• Gene: Tmem209 Location: Chr6:30480806-30509786 bp, - strand Genetic Position: Chr6, 12.52 cM
• Alliance: Tmem209^em2(IMPC)Tcp page
• IMPC: Tmem209 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0448 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ATGGCTCGCTAGTAAGCTAG and CATCTGCCACTCTAATTAAG targeting the 5' side and GGTCACCAGCTGGTTTCAGC and TCACACCTGGGATCCTCATG targeting the 3' side of exons ENSMUSE00001236619 (exon 4) and ENSMUSE00001262606 (exon 5) resulting in a 2198 bp deletion of Chr6 from 30505363 to 30507560 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tmem209 Mutation: 48 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)