About   Help   FAQ
Tmem121bem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem121bem2(IMPC)Tcp
Name: transmembrane protein 121B; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316222
Gene: Tmem121b  Location: Chr6:120465900-120470768 bp, - strand  Genetic Position: Chr6, 56.95 cM
Alliance: Tmem121bem2(IMPC)Tcp page
IMPC: Tmem121b gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0755 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GAGAGCGGCCGGGCAGCCCC and CGGGTGCATTGTCCTCGGAG targeting the 5' side and AGGAGCACCATAGCTGCTTC and CATTTTCCAAGTGGCCCCGC targeting the 3' side of exon ENSMUSE00001064169 resulting in a 1,669-bp deletion of Chr6 from 120492106 to 120493777_insTCT. (GRCm38) (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tmem121b Mutation:  18 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory