Tmem121b^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem121b^em2(IMPC)Tcp
• Name: transmembrane protein 121B; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316222
• Gene: Tmem121b Location: Chr6:120465900-120470768 bp, - strand Genetic Position: Chr6, 56.95 cM
• Alliance: Tmem121b^em2(IMPC)Tcp page
• IMPC: Tmem121b gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0755 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GAGAGCGGCCGGGCAGCCCC and CGGGTGCATTGTCCTCGGAG targeting the 5' side and AGGAGCACCATAGCTGCTTC and CATTTTCCAAGTGGCCCCGC targeting the 3' side of exon ENSMUSE00001064169 resulting in a 1,669-bp deletion of Chr6 from 120492106 to 120493777_insTCT. (GRCm38) (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tmem121b Mutation: 18 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)