Tenm4em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tenm4em2(IMPC)Tcp |
| Name: |
teneurin transmembrane protein 4; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316221 |
| Gene: |
Tenm4 Location: Chr7:95820453-96560300 bp, + strand Genetic Position: Chr7, 52.53 cM
|
| Alliance: |
Tenm4em2(IMPC)Tcp page
|
| IMPC: |
Tenm4 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0854 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs with spacer sequences of AAGTCTATGTTCAGTGGGGT and TGGTCAGTGGGCTACTGGCT targeting the 5' side and AATGGACCATAGTGTCCAGC and GGTATGAAGTACCTGGCCTC targeting the 3' side of a critical exon. This resulted in a 364-bp del Chr7:96694732 to 96695095; 250-bp del Chr7:96695161 to 96695410 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts.
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|