About   Help   FAQ
Tenm4em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Tenm4em2(IMPC)Tcp
Name: teneurin transmembrane protein 4; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316221
Gene: Tenm4  Location: Chr7:95820453-96560300 bp, + strand  Genetic Position: Chr7, 52.53 cM
Alliance: Tenm4em2(IMPC)Tcp page
IMPC: Tenm4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0854 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs with spacer sequences of AAGTCTATGTTCAGTGGGGT and TGGTCAGTGGGCTACTGGCT targeting the 5' side and AATGGACCATAGTGTCCAGC and GGTATGAAGTACCTGGCCTC targeting the 3' side of a critical exon. This resulted in a 364-bp del Chr7:96694732 to 96695095; 250-bp del Chr7:96695161 to 96695410 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tenm4 Mutation:  300 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory