Tedc1em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tedc1em2(IMPC)Tcp |
| Name: |
tubulin epsilon and delta complex 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316220 |
| Gene: |
Tedc1 Location: Chr12:113120041-113129668 bp, + strand Genetic Position: Chr12, 61.62 cM
|
| Alliance: |
Tedc1em2(IMPC)Tcp page
|
| IMPC: |
Tedc1 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0759 was generated at The Centre for Phenogenomics by electroporating Cas9 ribnucleoprotein complexes with four guide RNAs having spacer sequences of CACTACTACCCAGGTAAGCG and GCTAACCTGGAGATTTCACC targeting the 5' side and CTGTTGGGGAAATACCCGGC and GATACGTCAGGTAGAACTAG targeting the 3' side of exons ENSMUSE00000438166, ENSMUSE00000374366, and ENSMUSE00000304458 resulting in a 1249-bp deletion of Chr12 from 113157052 to 113158300 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|