Tagap1^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tagap1^em2(IMPC)Tcp
• Name: T cell activation GTPase activating protein 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316219
• Gene: Tagap1 Location: Chr17:7222410-7228555 bp, - strand Genetic Position: Chr17, 4.55 cM, cytoband A1
• Alliance: Tagap1^em2(IMPC)Tcp page
• IMPC: Tagap1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0804 was generated at The Centre for Phenogenomics by electroporating Cas9 ribnucleoprotein complexes with two guide RNAs having spacer sequences of GGCGTGCTGAACCGCATCAA targeting the 5' side and TGACAGAATGCATTTCCACC targeting the 3' side of exons ENSMUSE00000658353, ENSMUSE00001018647, ENSMUSE00000975105, and ENSMUSE00000455244 resulting in a 5,788-bp deletion of Chr17 from 6955245 to 6961032 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 33 and early truncation 74 amino acids later (p.I33Rfs*76). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tagap1 Mutation: 18 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)