Syt9em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Syt9em2(IMPC)Tcp |
| Name: |
synaptotagmin IX; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316218 |
| Gene: |
Syt9 Location: Chr7:106969935-107147863 bp, + strand Genetic Position: Chr7, 56.33 cM, cytoband F2
|
| Alliance: |
Syt9em2(IMPC)Tcp page
|
| IMPC: |
Syt9 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0867 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAGCTTGTTCATATAAATCT and CGAGGCTTAAAAATGAGGCC targeting the 5' side and TTGACAACCAAGTGCTTGCG and CGTCAACCACTCCCAAGCTC targeting the 3' side leading to a 2,313-bp deletion Chr7:107434925 to 107437237 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts.
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|