Smpdl3a^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smpdl3a^em2(IMPC)Tcp
• Name: sphingomyelin phosphodiesterase, acid-like 3A; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316217
• Gene: Smpdl3a Location: Chr10:57670640-57687926 bp, + strand Genetic Position: Chr10, 29.25 cM
• Alliance: Smpdl3a^em2(IMPC)Tcp page
• IMPC: Smpdl3a gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0788 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GAGAGCTGTGCTTAAACTCG and ACGTGCCAAAACTGCCCTGT targeting the 5' side and CACTGGGCAATCATGACTAC and TGTCAGAGTTATGACAGTGG targeting the 3' side of exons ENSMUSE00000098735, ENSMUSE00000724134, and ENSMUSE00001304146 resulting in a 1647-bp deletion of Chr10 from 57800909 to 57802555 and a 2-bp deletion of Chr10: 57802634 to 57802635 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Smpdl3a Mutation: 35 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)