Slc23a3em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Slc23a3em2(IMPC)Tcp |
| Name: |
solute carrier family 23 (nucleobase transporters), member 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics |
| MGI ID: |
MGI:6316215 |
| Gene: |
Slc23a3 Location: Chr1:75102185-75110534 bp, - strand Genetic Position: Chr1, 38.6 cM, cytoband C3
|
| Alliance: |
Slc23a3em2(IMPC)Tcp page
|
| IMPC: |
Slc23a3 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project TCPR0441 was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and four guide RNA with spacer sequences of CAGCGAGACTGAATAAATTA and GTCACGTGGTATGATACCTC targeting the 5' side and GGACTGTCGGGAGTAATCAA and GTTTAGATTATCAGGCCCTG targeting the 3' side of the critical exon resulting in an indel at Chr1:75132438-75132440_delTATinsACGTG and a 1076-bp deletion on Chr1 from 75131273 to 75132348 (GRCm38).
(J:200814)
|
|
|
|
|
| Original: |
J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013; |
| All: |
1 reference(s) |
|