About   Help   FAQ
Slc23a3em2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc23a3em2(IMPC)Tcp
Name: solute carrier family 23 (nucleobase transporters), member 3; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:6316215
Gene: Slc23a3  Location: Chr1:75102185-75110534 bp, - strand  Genetic Position: Chr1, 38.6 cM, cytoband C3
Alliance: Slc23a3em2(IMPC)Tcp page
IMPC: Slc23a3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0441 was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and four guide RNA with spacer sequences of CAGCGAGACTGAATAAATTA and GTCACGTGGTATGATACCTC targeting the 5' side and GGACTGTCGGGAGTAATCAA and GTTTAGATTATCAGGCCCTG targeting the 3' side of the critical exon resulting in an indel at Chr1:75132438-75132440_delTATinsACGTG and a 1076-bp deletion on Chr1 from 75131273 to 75132348 (GRCm38). (J:200814)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc23a3 Mutation:  24 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory