Shprh^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Shprh^em2(IMPC)Tcp
• Name: SNF2 histone linker PHD RING helicase; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:6316214
• Gene: Shprh Location: Chr10:11025171-11093339 bp, + strand Genetic Position: Chr10, 3.66 cM
• Alliance: Shprh^em2(IMPC)Tcp page
• IMPC: Shprh gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0622 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTAGCATGGCATACCATTGA and AGTTCCAAATCCTACCTAAC targeting the 5' side and AATGCCGTGCTCCAGAGAAT and TCTTGCGTCAACCCCTACTG targeting the 3' side of exon ENSMUSE00000891956 resulting in a 321-bp del of Chr10 from 11160323 to 11160643, and 3-bp del of Chr10 from 11160716 to 11160718 (GRCm38). (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Shprh Mutation: 83 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)